rs3783642 chr14:54893485 T>C
- Sequence
gtttctagaggtggacaaagcaaa[T/C]agcagagaaaatacaaaagcgggg
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) GM02255 (Lymphoblastoid Cell Lines) bipolar neuron
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.06 | 0.99 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP circulating galectin-3 levels, comorbid depressive syndrome and alcohol dependence, triglycerides change with statins
GTEx eQTL Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Heart_Left_Ventricle, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood