rs3784004 chr14:75615321 A>T
- Sequence
ggcagagtcaaagatgactaagat[A/T]attgaggaaggacacgcagatgga
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -3.27 | 2.20 | 2.20 | |||
| macrophages form periferal blood | 0.24 | 1.32 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 0.81 | -0.19 | 1.27 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), bipolar disorder, height, ldl cholesterol, tardive dyskinesia, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood