rs3784120 chr14:68408534 G>T
- Sequence
tcatccttttcaaagtggagccat[G/T]ccatgtagagcagacactgcaagc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -0.68 | 1.89 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, childhood acute lymphoblastic leukemia, cystatin c in serum, hdl cholesterol, height, ldl cholesterol, rheumatoid arthritis, total cholesterol