rs3784388 chr15:89894069 C>T
- Sequence
cggcactcggaaacttggccccgg[C/T]gctcacgagccctagcacccaagg
- ASB in cell types
- HEK293 (embryonic kidney) A549 (lung carcinoma) HepG2 (hepatoblastoma)
- ASB for transcription factors
- ZFX_HUMAN GABPA_HUMAN RBM25_HUMAN ZBT40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 0.16 | 1.22 | 1.00 | n/a | No Hit | |||
| GABPA_HUMAN | 0.11 | 2.15 | 1.54 | n/a | No Hit | |||
| RBM25_HUMAN | 1.64 | -0.20 | 1.00 | n/a | n/a | |||
| ZBT40_HUMAN | 0.37 | 0.13 | 1.00 | n/a | No Hit | |||
| BCL3_HUMAN | 0.32 | 1.30 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), homa-ir, ldl cholesterol, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood