rs3784698 chr15:67715244 G>C
- Sequence
ttttttttgggcggggaggggggg[G/C]gtctaaaattgtgtgtaacttaat
- ASB in cell types
- HEK293 (embryonic kidney) CD34+ iPSC-differentiated NSC
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.41 | 0.79 | 1.04 | |||
| CD34+ iPSC-differentiated NSC | -2.43 | 2.54 | 1.00 |
Items per page:
1 – 2 of 2