rs3785568 chr17:63946431 T>C
- Sequence
ggagcaggtcttgctcccagcaga[T/C]ctctcttcctggggaagtcccatt
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM10847 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.95 | 0.82 | 1.89 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, body mass index (bmi), cognitive response to topiramate treatment as measured by the controlled oral word association cognitive test, hdl cholesterol, height, hip bone mineral density (bmd)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood