rs378730 chr12:130281304 G>C
- Sequence
gcgcgcactgcctcagcctggcct[G/C]ccagcccccgagcctgggcccagc
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) sigmoid colon BE2C spleen
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -2.85 | 3.23 | 1.00 | |||
| sigmoid colon | 2.94 | -3.02 | 1.00 | |||
| BE2C | 2.27 | n/a | 1.00 | |||
| spleen | 1.92 | -1.61 | 1.00 |
Items per page:
1 – 4 of 4