rs380399 chr13:62511150 A>G
- Sequence
cccttaagtacgtcttgtgaggtt[A/G]gtctagtggtaacaaattccctta
- ASB in cell types
- VCaP (prostate carcinoma) TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 2.54 | -1.75 | 2.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 1.35 | -0.71 | 1.00 |
Items per page:
1 – 2 of 2