rs383316 chr19:29872344 T>A
- Sequence
cctgctccccgcccgcgggtgcct[T/A]cgctgatgagcctgaggcgggcag
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.06 | 2.78 | 1.57 | 0.43 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
