rs383915 chr5:151316163 T>C
- Sequence
tgtggacagtcttagctggctgca[T/C]ctcctttggccagttgctgccact
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia) T47D (invasive ductal carcinoma) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.72 | 0.84 | 1.11 | n/a | n/a |
Items per page:
1 – 1 of 1