rs385609 chr20:43657250 C>G
- Sequence
gagaaattaacctaataatagttg[C/G]aaacggaacaccgggcatgcagtg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.61 | 0.95 | 1.10 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, infant head circumference, refractive error, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Nerve_Tibial, Spleen, Testis, Whole_Blood