rs385893 chr9:4763176 T>C
- Sequence
gttccctttacgggttgttaaatg[T/C]ctacgtgagtaacccttgaatgtc
- ASB in cell types
- MDM(monocyte derived macrophages) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- SPI1_HUMAN COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.01 | 1.23 | 1.60 | n/a | No Hit | |||
| COT1_HUMAN | 2.02 | -1.69 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI granulocyte count, granulocyte percentage of myeloid white cells, hematological parameters, myeloid white cell count, neutrophil count, neutrophil percentage of white cells, platelet count, sum basophil neutrophil counts, sum neutrophil eosinophil counts, white blood cell count
GRASP chronic hepatitis b, height, hip bone mineral density (bmd), mean corpuscular hemoglobin (mch) (pg), mean red blood cell volume (fl), platelet count, platelet count (plt), platelet count (plt) (10^9/l), red blood cell count (rbc) (10^12/l, log), rheumatoid arthritis
PheWAS acquired deformities of limbs, allergic reaction to food, astigmatism, benign neoplasm of colon, benign neoplasm of unspecified sites, benign neoplasm of uterus, carcinoma in situ of skin, cerebral aneurysm, cerebral atherosclerosis, cervical cancer and dysplasia, cervical intraepithelial neoplasia (cervical dysplasia), chronic ulcer of skin, chronic ulcer of unspecified site, colon cancer, colorectal cancer, conduct disorders, conductive hearing loss, cyst or abscess of bartholins gland, digestive congenital anomalies, diplopia and disorders of binocular vision, disorders of refraction and accommodation, genu valgum or varum (acquired), herpes zoster with nervous system complications, hidradenitis, hirsutism, hypermetropia, infection/inflammation of internal prosthetic device, implant or graft, keratoconjunctivitis, noninfectious, lack of coordination, light-headedness and vertigo, lymphadenitis, malignant neoplasm of brain and nervous system, mechanical complication of nervous system device, implant, and graft, miscarriage, stillbirth, myopia, nephrotic syndrome without mention of glomerulonephritis, non-hodgkins lymphoma, other disorders of metabolic, endocrine, immunity disorders, other symptoms involving abdomen and pelvis, paroxysmal tachycardia, unspecified, paroxysmal ventricular tachycardia, pelvic peritoneal adhesions, female (postoperative) (postinfection), polyarthropathy or polyarthritis involving multiple sites nos, primary angle-closure glaucoma, pyogenic arthritis, severe protein-calorie malnutrition, symptoms affecting skin, symptoms of the muscles, synoviopathy, torsion dystonia, unspecified polyarthropathy or polyarthritis, upper gastrointestinal congenital anomalies, uterine leiomyoma, uveitis, vascular complications of surgery and medical procedures