rs385930 chr12:119781260 G>A
- Sequence
ttacagggtttccgtcctatgcac[G/A]tttatttataatgtttttatcaag
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | 2.19 | -1.91 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -1.26 | 1.26 | 1.00 |
Items per page:
1 – 2 of 2