rs386901 chr19:12294737 T>C
- Sequence
cccgggtcctcccaactcccgtag[T/C]cagggtaggtcccagcgcgacaaa
- ASB in cell types
- HEK293 (embryonic kidney) primary B-CLL cells GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.67 | 0.24 | 1.97 | |||
| primary B-CLL cells | 1.98 | n/a | 4.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.81 | 0.75 | 1.09 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood