rs387083 chr19:35356213 A>G
- Sequence
tgcacccgtgactcccctgcccca[A/G]tgttccctccagtggctctttgcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.01 | 0.16 | 1.20 | |||
| MS-1 (Small cell lung carcinoma) | -1.57 | 1.97 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 1.83 | -1.50 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-ir, ldl cholesterol change with statins, spine bone mineral density (bmd), stabilized warfarin dose, total cholesterol change with statins, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Pituitary, Prostate, Spleen, Thyroid, Uterus, Whole_Blood