rs387828 chr22:22855891 A>G
- Sequence
aggccaccagggggcgggggtggc[A/G]catgcctggacctgggaggtccct
- ASB in cell types
- K562 (myelogenous leukemia) VCaP (prostate carcinoma) GM19099 (female B-cells Lymphoblastoid Cell Lines) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.05 | 1.22 | 5.80 | |||
| VCaP (prostate carcinoma) | 2.92 | n/a | 2.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.14 | -0.50 | 1.00 | |||
| glioblastoma cells | 1.34 | n/a | 2.00 | |||
| adrenal gland | 2.21 | -1.89 | 1.00 |
Items per page:
1 – 5 of 5