rs388058 chr5:76641699 T>G
- Sequence
ggtttagatgtttctcttctgtat[T/G]cctatagcgccccctaccagtcac
- ASB in cell types
- Kelly (neuroblastoma) HUVEC-C (HUVEC, umbilical vein endothelial cells) GM19099 (female B-cells Lymphoblastoid Cell Lines) HCT-116 (colon carcinoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.01 | 0.86 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1