rs388286 chr20:56890368 C>T
- Sequence
ttaactgagagggtctagaagcaa[C/T]gtcaccttgatatcaacaagtaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7 WS8 cells MCF7L-P(immortalized breast epithelial cell line)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.70 | 1.95 | 3.61 | 3.96 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder and schizophrenia, hypertension (early onset hypertension), testicular dysgenesis syndrome, testicular dysgenesis syndrome (cryptorchidism subphenotype), testicular dysgenesis syndrome (testicular germ cell cancer subphenotype)