rs389409 chr1:32650943 C>T
- Sequence
tcaagaaaatggctgccctcttgc[C/T]gcgggagtgtgcggaccaaacctc
- ASB in cell types
- foreskin keratinocyte gastroesophageal sphincter CD14+ monocytes
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.04 | 1.85 | 1.13 | 0.50 | Weak Concordant | |||
| STAT1_HUMAN | n/a | 2.76 | 4.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
