rs390755 chr5:74543992 G>A
- Sequence
tctattgtgttgttggctttgtgc[G/A]tgtctgaaagaagagaagtcataa
- ASB in cell types
- HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- EPAS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EPAS1_HUMAN | 2.54 | -2.26 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute interstitial lung disease in gefitinib-treated non-small cell lung cancer, hypertension (early onset hypertension), infant head circumference, parkinsons disease, sporadic creutzfeldt-jakob disease, stabilized warfarin dose
GTEx eQTL Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood