rs392844 chr19:16182726 G>T
- Sequence
ggtctccatctcctgacctcgtga[G/T]ccgcccgcctcggcctcccaaagt
- ASB in cell types
- GM17942 (lymphoblastoid cell) neural progenitors MCF7 (Invasive ductal breast carcinoma) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 0.91 | -0.91 | 1.00 | |||
| neural progenitors | 2.38 | n/a | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.18 | 1.00 | 2.70 | |||
| THP-1 (acute monocytic leukemia) | 1.54 | -0.63 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis