rs393170 chr14:60151886 A>G
- Sequence
catctgtgtttactgaaagcatcc[A/G]gcatatcttatgagacacgtggtg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ETS1_HUMAN SMCA4_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | -1.30 | 2.90 | 1.00 | 4.47 | Concordant | |||
| SMCA4_HUMAN | -1.03 | 1.60 | 1.00 | n/a | n/a | |||
| FLI1_HUMAN | 0.12 | 2.27 | 1.11 | 3.65 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, body mass index (bmi), height, ldl cholesterol change with statins, partial epilepsy, schizophrenia, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid