rs39359 chr7:103830052 G>A
- Sequence
ataatgcaccatcagttgtaagac[G/A]ttaaaaaataaagtagacactgcc
- ASB in cell types
- naive endoderm
- ASB for transcription factors
- CDX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDX2_HUMAN | -2.56 | 2.48 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, bipolar disorder, hdl cholesterol, high myopia, hypertension (early onset hypertension), rheumatoid arthritis, stabilized warfarin dose