rs397940 chr3:139520429 A>G
- Sequence
tctctctgatccagaaattcactc[A/G]gggcacagtctagtcccaggctag
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) foreskin keratinocyte SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -2.48 | 2.38 | 1.00 | |||
| foreskin keratinocyte | 1.55 | -0.15 | 1.78 | |||
| SK-N-SH (neuroblastoma) | -2.52 | 2.62 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Hippocampus, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid