rs39824 chr5:169828518 G>A
- Sequence
tggggaaaccctgctgaggaaact[G/A]tattagtcatcactgaatgagctt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.29 | 0.87 | 1.11 | |||
| HCASMC (Human coronary artery smooth muscle cells) | 2.11 | n/a | 1.33 |
Items per page:
1 – 2 of 2