rs399280 chr16:85931392 C>G
- Sequence
agctggtcaacacggttcccactt[C/G]taaggcaggcagtgacctgtgctg
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.48 | -0.60 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, total cholesterol, urinary albumin-to-creatinine ratio