rs399856 chr21:42009479 G>A
- Sequence
ccagccgcggacctcggacggggg[G/A]aagggggctcctccaagcggggag
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte GM19239 (male B-cells lymphoblastoid cell line) Peyer's patch
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.21 | 1.11 | 1.52 | n/a | No Hit | |||
| STAG1_HUMAN | 0.24 | 0.88 | 1.24 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Liver, Muscle_Skeletal, Spleen