rs399907 chr21:42009537 G>A
- Sequence
ggccgagcagcagggctcctggcc[G/A]gcggagggtgctatgctctgcggg
- ASB in cell types
- K562 (myelogenous leukemia) GM12892 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.13 | 1.60 | 1.46 | 2.12 | Concordant | |||
| STAG1_HUMAN | -0.95 | 1.50 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Liver, Muscle_Skeletal, Spleen