rs401074 chr21:42593381 A>G
- Sequence
gggctcccgaaaggccgctcccag[A/G]ttttgattttgctttgttacctag
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma) glioblastoma patient-derived cell model GM02610 (Lymphoblastoid Cell Lines) T47D (invasive ductal carcinoma)
- ASB for transcription factors
- KDM2B_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM2B_HUMAN | -0.14 | 2.25 | 1.00 | n/a | n/a | |||
| SMCA4_HUMAN | 0.19 | 1.50 | 1.14 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Testis, Thyroid