rs40119 chr5:39283651 G>A
- Sequence
tgataaatcattaagctagcccta[G/A]ggggtctggtcaaggctcagctct
- ASB in cell types
- K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.45 | 0.97 | 1.06 | |||
| MS-1 (Small cell lung carcinoma) | -0.58 | 1.53 | 1.00 |
Items per page:
1 – 2 of 2