rs40394 chr5:112116680 C>T
- Sequence
ctctattatgcaactgaaggcttg[C/T]tattatcatattaatttaaaagta
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ARNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARNT_HUMAN | -2.45 | 2.39 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, chronic obstructive pulmonary disease (copd), cystatin c in serum, homa-b, ldl cholesterol, ldl cholesterol change with statins, prop taste detection threshold, sporadic creutzfeldt-jakob disease, tardive dyskinesia, total cholesterol change with statins
GTEx eQTL Artery_Aorta, Artery_Tibial, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid