rs404339 chr1:200917763 C>G
- Sequence
gaacaagacattgcctgagacttt[C/G]agtgacacctcctctagctgacag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- PKNX1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | n/a | 3.32 | 3.00 | 5.07 | Concordant | |||
| GCR_HUMAN | n/a | 2.40 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP bipolar disorder, crohns disease, combined control dataset, irritible bowel syndrome, ldl cholesterol, major depressive disorder
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Minor_Salivary_Gland, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood