rs408462 chr14:35985714 T>C
- Sequence
cccttgtggtagagttctctatta[T/C]gctgctcgctcgtgcctgatttgc
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines) LNCaP (prostate carcinoma) LNCaP C4-2B (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.19 | 2.15 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, irritible bowel syndrome, neuroblastoma (brain cancer), spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease