rs408569 chr11:9716231 T>C
- Sequence
agtgataggtgaatagatgaaata[T/C]ggagacatgggaggtgagaagttg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -0.13 | 1.43 | 1.77 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting insulin, homa-ir, ldl cholesterol change with statins, systolic blood pressure (sbp), total cholesterol change with statins, transmission distortion
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid