rs408717 chr19:27374751 A>C
- Sequence
tcccaatgctatccctccctcctc[A/C]ccacaccccacaactgtccccata
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | n/a | 1.46 | 2.50 | |||
| HepG2 (hepatoblastoma) | 2.17 | -2.16 | 1.00 |
Items per page:
1 – 2 of 2