rs409408 chr16:77584291 C>T
- Sequence
gttgaaactcgttacttggtaatc[C/T]cctcgaaggcagaagctaaatctt
- ASB in cell types
- A549 (lung carcinoma) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.23 | 0.56 | 2.00 | |||
| RWPE1 (prostate epithelial cells) | 1.61 | -1.40 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd