rs409773 chr5:74361935 T>C
- Sequence
caatgagcccattgttctcaagcc[T/C]gtgctgagaaataatatgtacaaa
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -1.94 | 2.42 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, comorbid depressive syndrome and alcohol dependence, ldl cholesterol change with statins, primary rhegmatogenous retinal detachment, spine bone mineral density (bmd), total cholesterol change with statins, triglycerides change with statins, urinary albumin-to-creatinine ratio, waist hip ratio, years of education