rs40992 chr5:111512269 C>T
- Sequence
ccccaacgtccaccgcgagctccc[C/T]agatccatggtctggagcaggtcc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) monocytes from periferal blood
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 1.31 | -1.07 | 3.00 | -3.00 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
