rs409937 chr14:58805423 C>G
- Sequence
aaggtcttagtttgtggcaaaact[C/G]cattttatttagctttaaccagaa
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.71 | 0.26 | 1.14 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, childhood acute lymphoblastic leukemia, ldl cholesterol change with statins, total cholesterol change with statins, waist hip ratio