rs410629 chr19:46967605 T>C
- Sequence
tccaaaataaatgggatcacttca[T/C]cttcacctgcttaaaactcatcag
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- FLI1_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FLI1_HUMAN | -1.04 | 1.95 | 1.00 | n/a | No Hit | |||
| SMCA4_HUMAN | 0.36 | 1.37 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, bipolar disorder, infant head circumference, ldl cholesterol change with statins, severe diabetic retinopathy, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Spleen, Whole_Blood