rs411089 chr1:158255035 C>T
- Sequence
actctggcacctttctctctccat[C/T]ctctttctcaatgtctttctcccc
- ASB in cell types
- J-Lat A72
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.73 | -1.31 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), breast cancer, ldl cholesterol change with statins, parkinsons disease (pd), partial epilepsy, premature ovarian failure, total cholesterol change with statins, triglycerides change with statins