rs412303 chr6:2854133 G>A
- Sequence
ggaaactgagtcccccacagtttc[G/A]tttcctcaatcgagctaattactg
- ASB in cell types
- macrophages form periferal blood GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.24 | 1.36 | 2.02 | 2.35 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
