rs412334 chr11:61792789 C>T
- Sequence
ccagggtcgctgagagactctgtt[C/T]tccctggagggactggttgccatg
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma) primary B-CLL cells HL-60 (acute myeloid leukemia)
- ASB for transcription factors
- BRD4_HUMAN ANDR_HUMAN INT13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.54 | 0.28 | 1.25 | n/a | n/a | |||
| ANDR_HUMAN | 3.04 | 0.00 | 1.78 | -1.94 | Weak Concordant | |||
| INT13_HUMAN | -0.00 | 1.72 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP hdl cholesterol, ldl cholesterol, plasma alpha-linolenic acid levels, plasma docosapentaenoic acid levels, plasma eicosapentaenoic acid levels, plasma oleic acid, plasma stearic acid, total cholesterol, triglycerides, triglycerides change with statins