rs412775 chr21:36567503 T>C
- Sequence
tttaactcaggggccttccttaat[T/C]acagcacgattacatgaccacttt
- ASB in cell types
- HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- EPAS1_HUMAN E2F8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EPAS1_HUMAN | 3.09 | -3.23 | 1.00 | n/a | No Hit | |||
| E2F8_HUMAN | 2.65 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), irritible bowel syndrome, ldl cholesterol change with statins, rheumatoid arthritis, salmonella-induced pyroptosis, total cholesterol