rs41293273 chr1:46340721 T>C
- Sequence
ggagagcgtcagatgtatttcctt[T/C]cccttttttcgctcgtgtcccgcc
- ASB in cell types
- MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) esophagus squamous epithelium CD14+ monocytes naive IgD+ B cells
- ASB for transcription factors
- CDN1B_HUMAN CTCF_HUMAN STAT1_HUMAN FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDN1B_HUMAN | -0.17 | 1.73 | 1.50 | n/a | n/a | |||
| CTCF_HUMAN | 0.39 | 1.17 | 1.47 | n/a | No Hit | |||
| STAT1_HUMAN | 1.52 | 0.14 | 2.00 | -2.85 | Concordant | |||
| FOXP1_HUMAN | 2.82 | -5.34 | 2.00 | n/a | No Hit | |||
| INT13_HUMAN | -0.62 | 1.61 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 9
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood