rs41294 chr7:28626875 C>A
- Sequence
gatttggggaaaggggccccagga[C/A]ggcttcaatttcttttctgttcct
- ASB in cell types
- H929 (plasma cell myeloma) heart left ventricle CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -1.63 | 1.90 | 1.00 | |||
| heart left ventricle | 1.99 | -1.72 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | n/a | 2.94 | 2.00 |
Items per page:
1 – 3 of 3