rs413092 chr1:16609286 G>T
- Sequence
cgttagttaatgcttattaaagta[G/T]ctttggaatctcatctactggtct
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.41 | -0.56 | 1.79 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.06 | -0.10 | 2.04 |
Items per page:
1 – 2 of 2