rs413621 chr21:42976026 C>A
- Sequence
atttggaagatggcaggctgaccc[C/A]aatgagcctttcatcactctgctt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ILF3_HUMAN MEIS2_HUMAN TAF9B_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ILF3_HUMAN | -1.80 | 2.20 | 1.00 | n/a | n/a | |||
| MEIS2_HUMAN | 1.94 | -1.72 | 1.00 | n/a | No Hit | |||
| TAF9B_HUMAN | n/a | 2.84 | 1.00 | n/a | n/a | |||
| FOXK2_HUMAN | -1.00 | 1.97 | 1.00 | n/a | No Hit | |||
| ANDR_HUMAN | n/a | 2.82 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid