rs41409548 chr22:17098605 G>A
- Sequence
ctgggaaataactgtctgcaaggc[G/A]gtaggctgaggccagagagtgaac
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood macrophages
- ASB for transcription factors
- SPI1_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.76 | n/a | 2.67 | n/a | No Hit | |||
| CEBPB_HUMAN | 2.52 | -1.55 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2