rs41414547 chr3:5464129 C>G
- Sequence
agtttggtgtgggaggaaggggat[C/G]ggagtgcaaagagtaactatgaat
- ASB in cell types
- macrophages form periferal blood CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.50 | -0.05 | 3.00 | 0.52 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
